Font
Large
Medium
Small
Night
Prev Index    Favorite Next

Chapter 9764 fight again

"Swish!" He said it again and soon, a stream of earth Xuan spiritual energy was released from Guan Heng's palm, and then he shook his hand and threw it forward. "Huhuhuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-Wuhu-W

"Guaga?!" The somewhat sensitive mutant monster bird suddenly noticed something was wrong and wanted to disperse around and avoid it. But at this moment, the angry sarcoma monster bird king suddenly roared: "Guagaga!"

What it means is that there is something fussing about, it is just a slight vibration from the ground, which makes you waste panic?

Although these mutated monster birds survived many times and their abilities have increased a lot, in front of the monster bird king, they still felt that they were just scumbags, so they all stopped in place tremblingly and did not dare to move. But in an instant, the monster bird king himself was in trouble.

"Swish swish swish swish!" In the flash of lightning, the earth-Xuan spiritual energy surged to the feet of the strange bird king, and then suddenly grabbed the guy's ankle.

"Bang!" The unlucky monster bird king immediately stood steadily, and he turned over and fell to the ground, looking very embarrassed. Seeing this, the other mutant monster birds all had disdain and contempt in their eyes, and they began to contempt for this guy in their hearts.

The angry sarcoma monster bird king struggled to get up, then glanced at the guys around, intending to find a guy with a little disrespect and kill him to vent his anger.

But the monster bird king was disappointed. These sperm-forming sarcoma monsters were all depressed and did not let it see its expression. Even if it was secretly laughing, the monster bird king didn't know. However, at this moment, the monster bird king could not take his anger on all his companions, so he could only breathe secretly, which was really uncomfortable.

"Quaguaguaguaguaguaguaguaguagua!" There was no way, the somewhat angry sarcoma monster bird king roared and screamed at the mutant monster bird, signaling the group of guys to follow him, and then running forward on his own.

To be honest, these guys have no idea what fate they will face in the future, but as long as it is about the Monster Bird King, it will definitely not be a good thing.

So the ten birds of prey leaders and the mutant monster birds looked at each other, and suddenly they had a tacit understanding: "No matter what, as long as it threatens our survival, they will die! Even if it is the king!"

In fact, there were more than ten mutant monster birds in this huge nest. Soon after, everyone came to a huge and wide platform area.

Dozens of mutant monster birds have been waiting here. They all have strange appearances, hideous and terrifying appearances. Even the ferocity that radiates all over their bodies is strange and weird. No matter who sees the other party, they will inevitably be frightened!

"Gaga-Wuga-" In an instant, the sarcoma monster bird king screamed. The command of its voice was very simple, and it was no different from before. It was to let you fight each other!

This time, the Monster Bird King did not even specify the time for the fight. It seemed that it wanted to see how many dead leftovers could survive within a certain time limit, so that those left behind could make full use of the guys.

"Jiji!" In an instant, an extremely ugly mutant monster bird reached the middle of the platform, and then roared at the other people. This guy was extremely irritable and didn't want to wait for bad luck to come, so he would rather die in battle than wait.

Since the first guy launched a war and provocation, there were naturally many ignorant guys, and immediately rushed out to fight.

"Shou--" It was said in a flash. At that time, the opponent was several feet away from the first monster bird, and he was already jumping up wildly. He jumped very high, and then attacked the opponent with his sharp beak.

It seems that the guy who came out to fight had a strong jumping force on both feet, and his characteristics after the mutation were all reflected in this.

But the first mutant monster bird to challenge was calm and calm. It just slammed its wings and suddenly blew a strong wind. "Huhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

Before this guy could get up, the first strange bird jumped over without hesitation, tearing open the other party's chest with his claws, and pinching his heart to eat.

Then, this extremely arrogant guy glanced at his fellow people with provocative eyes, and it seemed like he was asking, who else came up to die?

In fact, the first monster bird to fight and provoke is not the top of its kind. Moreover, the guy who jumped out to fight first consumed his energy and had no hope of fighting to the end. However, no one took this seriously. Instead, he hoped that the other party could hold on for a while.

Of course, it would be even better if this guy who is looking for a beating can eliminate more idiots who are overestimating their abilities.

"Huh!" After a few breaths, another strange bird rushed forward and started fighting with the other party...

The battles looked extremely boring, but a group of ugly monster birds were fighting each other. The winner lived and the loser died. There was no third way to go.

The water mythical beast who was watching the battle invisibly nearby was a little impatient. It said: "Guan Heng, why are we wasting time here? Hurry up and find the sea skeleton."

"Don't worry."

Guan Heng said casually: "I guess even if I go and search, I may not be able to find it now. The colorful ferocious frog I sent out just now has found the nest of the Monster Bird King above the nest. There is nothing but the half-piece of the black helmet and arm king's corpse left by the dead bird."

"Is that so? What should I do?" Hearing this, the Shui Xuan Ling Beast became more and more anxious.

Guan Heng said, "Don't worry, since the leader of the Raptor and those minions presented the Black Helmet Arm King to the Monster Bird King, the sea skeleton must be in its hands, but it was hidden by this guy. I think as long as I seize the opportunity, I will definitely be able to seize it."

"I still say the same thing, don't alert the snake first, find an opportunity to stimulate the monster bird king. Ninety-nine percent of this guy will think that the hidden bones are unsafe, and then hurry up and transfer the sea skeletons. By that time, we can do it."

"So that's it, this makes sense!" Hearing Guan Heng's plan, the Shui Xuan Ling Beast nodded repeatedly and said, "Yeah, you're still smart, so do that."

"Look, the battle between the mutant monster birds in front seems to be coming to an end."

As he said that, the unicorn ice dragon pointed to the front. It turned out that it was a one-on-one decisive battle at the beginning, but the Sarcoma Monster Bird King seemed to be dissatisfied with this method of fighting and thought it was too slow, so he ordered these mutant monster birds to fight.

But the strange birds became more and more slippery, and they didn't seem to want to fight like this and their speed was slower and slower.

"Quaga, Quaga!"
Chapter completed!
Prev Index    Favorite Next